Loading…

Luminescence of telomeric fragments of DNA macromolecule

Optical absorption, fluorescence and phosphorescence spectra of the telomere fragment d(AGGGTTAGGGTTAGGGTTAGGG) (Tel22) were studied and compared with those of the native DNA. Main centers of optical absorption in telomeres are A, T and G nucleic bases and G-quadruplexes. The fluorescence of telomer...

Full description

Saved in:
Bibliographic Details
Published in:Molecular Crystals and Liquid Crystals 2016-11, Vol.639 (1), p.151-159, Article 1
Main Authors: Yashchuk, Valeriy M., Kudrya, Vladislav Yu, Dubey, Igor Ya, Kovalyuk, Kateryna I., Batsmanova, Olesya I., Mel'nik, Volodymyr I., Klishevich, Georgiy V.
Format: Article
Language:English
Subjects:
Citations: Items that this one cites
Items that cite this one
Online Access:Get full text
Tags: Add Tag
No Tags, Be the first to tag this record!
Description
Summary:Optical absorption, fluorescence and phosphorescence spectra of the telomere fragment d(AGGGTTAGGGTTAGGGTTAGGG) (Tel22) were studied and compared with those of the native DNA. Main centers of optical absorption in telomeres are A, T and G nucleic bases and G-quadruplexes. The fluorescence of telomeres is associated mainly with G-bases and other long-wave centers, possibly G-quadruplex structures, whereas their phosphorescence is associated with AT-sequences as it takes place for the native DNA. A significant increase of phosphorescence-to-fluorescence intensity ratio was observed for Tel22 as compared to DNA. Results obtained are promising for the detection of DNA macromolecules containing the extended telomeric sequences.
ISSN:1542-1406
1563-5287
1527-1943
DOI:10.1080/15421406.2016.1255068