Loading…
Luminescence of telomeric fragments of DNA macromolecule
Optical absorption, fluorescence and phosphorescence spectra of the telomere fragment d(AGGGTTAGGGTTAGGGTTAGGG) (Tel22) were studied and compared with those of the native DNA. Main centers of optical absorption in telomeres are A, T and G nucleic bases and G-quadruplexes. The fluorescence of telomer...
Saved in:
Published in: | Molecular Crystals and Liquid Crystals 2016-11, Vol.639 (1), p.151-159, Article 1 |
---|---|
Main Authors: | , , , , , , |
Format: | Article |
Language: | English |
Subjects: | |
Citations: | Items that this one cites Items that cite this one |
Online Access: | Get full text |
Tags: |
Add Tag
No Tags, Be the first to tag this record!
|
Summary: | Optical absorption, fluorescence and phosphorescence spectra of the telomere fragment d(AGGGTTAGGGTTAGGGTTAGGG) (Tel22) were studied and compared with those of the native DNA. Main centers of optical absorption in telomeres are A, T and G nucleic bases and G-quadruplexes. The fluorescence of telomeres is associated mainly with G-bases and other long-wave centers, possibly G-quadruplex structures, whereas their phosphorescence is associated with AT-sequences as it takes place for the native DNA. A significant increase of phosphorescence-to-fluorescence intensity ratio was observed for Tel22 as compared to DNA. Results obtained are promising for the detection of DNA macromolecules containing the extended telomeric sequences. |
---|---|
ISSN: | 1542-1406 1563-5287 1527-1943 |
DOI: | 10.1080/15421406.2016.1255068 |