Development of real-time polymerase chain reaction for analysis of rat meat ( Bandicota bengalensis ) in beef meatballs for halal authentication

• Published in: Open veterinary journal (Tripoli, Libya) Libya), 2024-09, Vol.14 (9), p.2484-2492
• Main Authors: Rohman, Abdul, Nawwaruddin, Hazza' Hammam, Hossain, M A Motalib, Laksitorini, Marlyn Dian, Lestari, Dwi
• Format: Article
• Language: English
• Subjects: Animals; Cattle; Food Contamination - analysis; halal authentication; Meat - analysis; Meat Products - analysis; meatball; rat meat; Rats; Real-Time Polymerase Chain Reaction - methods; Real-Time Polymerase Chain Reaction - veterinary; Red Meat - analysis; rt-pcr; Sensitivity and Specificity; species-specific primer
• ISSN: 2218-6050; 2226-4485; 2218-6050
• DOI: 10.5455/OVJ.2024.v14.i9.37

Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like rat meat (RM). This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs. This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples. The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3 C over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination ( ) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples. The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.