ALLELIC POLYMORPHISMS AS MODIFILERS OF CLINICAL OUTCOME IN COLORECTAL CANCER

• Published in: Anticancer research 2008-10, Vol.28 (5C)
• Main Authors: Tibold, A, Csejtei, A, Varga, Z, Koltai, K, Ember, A, Orsos, Z, Ember, I, Kiss, I
• Format: Article
• Language: English
• ISSN: 0250-7005

Background: Cancers of the colorectal region are the second most frequent cause of death among malignant diseases. We investigated the influence of two allelic polymorphisms of the GSTM1 and GSTT1 metabolyzing enzymes and that of p53 tumor suppressor gene codon 72 polymorphisms on colon cancer. Materials and Methods: 102 intraoperatively removed tissue samples from patients with colorectal cancer were processed. Cancer-free human samples were used a matched controls. After deparaffination, samples were digested with proteinase-K. DNA solutions were used for PCR amplification. For amplification the following primers were used: GSTT1 forward primer 5'-TT CCT TAC TGG TCC TCA CAT CTC-3'; GSTT1, reverse primer 5'-TCA CCG GAT CAT GGC CAG CA -3'; and GST M1 forward primer: 5'-GAA CTC CCT GAA AAG CTA AAG C-3', GSTM1 reverse primer 5'-GTT GGG CTC AAA TAT ACG GTG G-3'. P53 genotyping (codon 72, Arg/Pro polymorphism) was performed using 3' primer: GC AAC TGA CCG TGC AAG TCA and 5' primers for Arg variant ATGCCAGAGGCTGCTCCCCG and for the Pro allele ATG CCA GAG GCT GCT CCC CC. Results and Discussion: No significant difference was found between cancer patients and controls in respect to GSTM1, GSTT1 and p53 polymorphisms. Kaplan-Meier curves were defined in all Dukes' stages. Significant association was found in stage Dukes' B patients between the GSTM1 and p53 gene variant and survival. The chance of survival was significantly lower in patients with GSTM1 0 genotype and in p53 Arg/Pro heterozygotes or Pro/Pro homozygotes than in the case of GSTM1+ and p53 Arg/Arg variants (p=0.0089 and p=0.0008). The relevance of the investigated polymorphisms on prognosis is dependent on the tumor stage. These parameters might be used in certain cases as prognostic biomarkers and in the planning of individualized therapy.