Human Chromosomal Fragile Site FRA16B Is an Amplified AT-Rich Minisatellite Repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG) n trinucleotide repeats; however, the relationsh...

Full description

Saved in:
Bibliographic Details
Published in:Cell 1997-02, Vol.88 (3), p.367-374
Main Authors: Yu, Sui, Mangelsdorf, Marie, Hewett, Duncan, Hobson, Lynne, Baker, Elizabeth, Eyre, Helen J, Lapsys, Naras, Le Paslier, Denis, Doggett, Norman A, Sutherland, Grant R, Richards, Robert I
Format: Article
Language:English
Subjects:
Base Composition
Base Sequence
Blotting, Southern
Chromosome Fragile Sites
Chromosome Fragility
Chromosomes, Human, Pair 16
Cloning, Molecular
DNA, Satellite - chemistry
Gene Amplification
Humans
Minisatellite Repeats
Molecular Sequence Data
Polymerase Chain Reaction
Polymorphism, Genetic
Citations: Items that this one cites
Items that cite this one
Online Access:Get full text
Tags: Add Tag
No Tags, Be the first to tag this record!
Description
Summary:Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG) n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A–sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATAT C/ ATA) n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
ISSN:0092-8674
1097-4172
DOI:10.1016/S0092-8674(00)81875-9