Sensitive and Specific Detection of Toxoplasma DNA in an Experimental Murine Model: Use of Toxoplasma gondii-Specific cDNA and the Polymerase Chain Reaction

Toxoplasma gondii, an apicomplexan parasite of mammals and birds, is wen recognized as a cause of encephalitis in AIDS patients and as a cause of congenital infections. The polymerase chain reaction (PeR) and toxoplasma cDNA clones were used to diagnose T. gondii infection in an acute murine model o...

Full description

Saved in:
Bibliographic Details
Published in:The Journal of infectious diseases 1991-01, Vol.163 (1), p.180-186
Main Authors: Weiss, Louis M., Udem, Stephen A., Salgo, Miklos, Thnowitz, Herbert B., Wittner, Murray
Format: Article
Language:English
Subjects:
Animals
Antibodies
Base Sequence
Biological and medical sciences
Blotting, Southern
Complementary DNA
Disease Models, Animal
DNA
DNA, Protozoan - analysis
DNA, Protozoan - genetics
Encephalitis
Female
Human protozoal diseases
Infections
Infectious diseases
Major Articles
Medical sciences
Mice
Molecular Sequence Data
Nucleic Acid Hybridization
Parasitic diseases
Polymerase Chain Reaction
Predictive Value of Tests
Protozoal diseases
Spleen
Tachyzoites
Toxoplasma - genetics
Toxoplasma - isolation & purification
Toxoplasmosis
Toxoplasmosis, Animal - diagnosis
Citations: Items that cite this one
Online Access:Get full text
Tags: Add Tag
No Tags, Be the first to tag this record!
Description
Summary:Toxoplasma gondii, an apicomplexan parasite of mammals and birds, is wen recognized as a cause of encephalitis in AIDS patients and as a cause of congenital infections. The polymerase chain reaction (PeR) and toxoplasma cDNA clones were used to diagnose T. gondii infection in an acute murine model of toxoplasmosis. Diagnosis of tissue infection by Southern blot hybridization with cDNA clones of T. gondii was possible within 5 days of infection. This technique could detect as few as 10,000 organisms. Specific T. gondii gene amplification by PCR using the primers 5′CACACGGTIGTAlGlCGGTTICGCn′ and 5′lCAAGGAGCICAAlGTTACAGCCf3′ followed by oligonucleotide hybridization using 5′GCGGlCATIClCACACCGACGGAGAACCACTfCAClCTCA3′ allowed detection of T. gondii in the tissue of mice by day 2 after infection and in the blood of mice by day 5 after infection with RH strain T. gondii. This technique could detect as few as 10 organisms. Thus, these techniques may be useful in the diagnosis of toxoplasmosis.
ISSN:0022-1899
1537-6613
DOI:10.1093/infdis/163.1.180