The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

• Published in: Microbiology (Society for General Microbiology) 2010-02, Vol.156 (2), p.374-384
• Main Authors: van der Veen, Stijn, van Schalkwijk, Saskia, Molenaar, Douwe, de Vos, Willem M, Abee, Tjakko, Wells-Bennik, Marjon H. J
• Format: Article
• Language: English
• Subjects: antibiotic ciprofloxacin; bacillus-subtilis; Bacteriology; Biological and medical sciences; Cell Division - drug effects; cell-division; deficient escherichia-coli; DNA Damage; DNA, Bacterial - genetics; DNA, Bacterial - metabolism; dna-polymerases; Fundamental and applied biological sciences. Psychology; gene-expression; Genes, Bacterial - drug effects; Genetics; heat-shock response; identification; Listeria monocytogenes; Listeria monocytogenes - genetics; Listeria monocytogenes - metabolism; Listeria monocytogenes - physiology; Microbiology; Mitomycin - pharmacology; Mutagenesis - drug effects; Rec A Recombinases - physiology; reca protein; Regulon - drug effects; replication; SOS Response (Genetics) - drug effects; SOS Response (Genetics) - genetics; Stress, Physiological
• ISSN: 1350-0872; 1465-2080
• DOI: 10.1099/mic.0.035196-0

1 Top Institute Food and Nutrition (TIFN), Nieuwe Kanaal 9A, 6709 PA Wageningen, The Netherlands 2 Division of Health and Safety, NIZO Food Research, Kernhemseweg 2, 6718 ZB Ede, The Netherlands 3 Laboratory of Food Microbiology, Wageningen University and Research Centre, Bomenweg 2, 6703 HD Wageningen, The Netherlands The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologues, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of a wild-type strain and a recA mutant strain after exposure to the DNA-damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA-regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA-regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; recA cultures showed considerably lower rifampicin- and streptomycin-resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA - and yneA -promoter reporter studies. Stress-survival studies showed recA mutant cells to be less resistant to heat, H 2 O 2 and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host. Correspondence Stijn van der Veen Stijn.vanderVeen{at}wur.nl Abbreviations: MMC, mitomycin C; Q-PCR, quantitative real-time PCR The microarray data associated with this paper are available at GEO ( http://www.ncbi.nlm.nih.gov/geo ) under accession number GSE12634 . A supplementary figure is available with the online version of this paper.